Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRHOBTB3 | |||
Gene | RHOBTB3 | Organism | Human |
Genome Locus | chr5:95091100-95099324:n/a | Build | hg19 |
Disease | Colon Cancer | ICD-10 | Malignant neoplasm of Colon, unspecified (C18.9) |
DBLink | Link to database | PMID | 27892494 |
Experimental Method | |||
Sample Type | DKO-1, Dks-8, and DLD-1 Cell Lines | Comparison | Exosomes were isolated from conditioned medium of DKO-1, Dks-8, and DLD-1 cells |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TAAAGGCTGAAGCGTCACATTAT ReverseCTCGATTACATTTGAAACATCCCCA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Dou, Y, Cha, DJ, Franklin, JL, Higginbotham, JN, Jeppesen, DK, Weaver, AM, Prasad, N, Levy, S, Coffey, RJ, Patton, JG, Zhang, B (2016). Circular RNAs are down-regulated in KRAS mutant colon cancer cells and can be transferred to exosomes. Sci Rep, 6:37982. |